Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

common in clinvar
Is agenotype
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation