Have questions? Visit https://www.reddit.com/r/SNPedia

rs193302859(-;-)

From SNPedia
(Redirected from Rs193302859(T;T))

Mucolipidosis III gamma
Is agenotype
ofrs193302859
GeneGNPTG
Chromosome16
Position1,362,641
mentionedby
Magnitude6.1
ReputeBad
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;GAGGATGCTGGCTACTTAAAGACCCCAG) 3 Carrier of a mucolipidosis III gamma mutation
(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG) 0 common in clinvar

See ClinVar sidebar on main rs/page for details.