Have questions? Visit https://www.reddit.com/r/SNPedia

rs193302853

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 6.1 Mucolipidosis III gamma
(-;A) 3 Carrier of a mucolipidosis III gamma mutation
(GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC;GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC) 0 common in clinvar
Make rs193302853(-;GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC)
ReferenceGRCh38 38.1/141
Chromosome16
Position1362562
GeneGNPTG
is asnp
is mentioned by
dbSNPrs193302853
ClinGenrs193302853
ebirs193302853
HLIrs193302853
Exacrs193302853
Varsomers193302853
Maprs193302853
PheGenIrs193302853
hapmaprs193302853
1000 genomesrs193302853
hgdprs193302853
ensemblrs193302853
gopubmedrs193302853
geneviewrs193302853
scholarrs193302853
googlers193302853
pharmgkbrs193302853
gwascentralrs193302853
openSNPrs193302853
23andMers193302853
23andMe allrs193302853
SNP Nexus

SNPshotrs193302853
SNPdbers193302853
MSV3drs193302853
GWAS Ctlgrs193302853
Max Magnitude6.1

c.609+28_610-16del (del34)

ClinVar
Risk Rs193302853(-;-)
Alt Rs193302853(-;-)
Reference Rs193302853(GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC;GTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC)
Significance Pathogenic
Disease Mucolipidosis III Gamma
Variation info
Gene GNPTG
CLNDBN Mucolipidosis III Gamma
Reversed 0
HGVS NC_000016.9:g.1412563_1412596del34
CLNSRC GeneReviews
CLNACC RCV000020922.2,