Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994204

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(TATTACTATCCTTGAGCTCCC;TATTACTATCCTTGAGCTCCC) 0 common in clinvar
Make rs113994204(-;-)
Make rs113994204(-;TATTACTATCCTTGAGCTCCC)
ReferenceGRCh38 38.1/141
Chromosome17
Position3648904
GeneCTNS, LOC105371493
is asnp
is mentioned by
dbSNPrs113994204
dbSNP (old)rs113994204
ClinGenrs113994204
ebirs113994204
HLIrs113994204
Exacrs113994204
Gnomadrs113994204
Varsomers113994204
Maprs113994204
PheGenIrs113994204
Biobankrs113994204
1000 genomesrs113994204
hgdprs113994204
ensemblrs113994204
gopubmedrs113994204
geneviewrs113994204
scholarrs113994204
googlers113994204
pharmgkbrs113994204
gwascentralrs113994204
openSNPrs113994204
23andMers113994204
23andMe allrs113994204
SNP Nexus

SNPshotrs113994204
SNPdbers113994204
MSV3drs113994204
GWAS Ctlgrs113994204
Max Magnitude0
ClinVar
Risk rs113994204(-;-)
Alt rs113994204(-;-)
Reference Rs113994204(TATTACTATCCTTGAGCTCCC;TATTACTATCCTTGAGCTCCC)
Significance Other
Disease Nephropathic cystinosis
Variation info
Gene CTNS
CLNDBN Nephropathic cystinosis
Reversed 0
HGVS NC_000017.10:g.3552198_3552218del21
CLNSRC ClinVar GeneReviews
CLNACC RCV000020623.4,