Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886346

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(GAAGGCCCTCCTGGGCCACCC;GAAGGCCCTCCTGGGCCACCC) 0 common in clinvar
Make rs104886346(-;-)
Make rs104886346(-;GAAGGCCCTCCTGGGCCACCC)
ReferenceGRCh38 38.1/141
ChromosomeX
Position108603023
GeneCOL4A5
is asnp
is mentioned by
dbSNPrs104886346
dbSNP (old)rs104886346
ClinGenrs104886346
ebirs104886346
HLIrs104886346
Exacrs104886346
Gnomadrs104886346
Varsomers104886346
Maprs104886346
PheGenIrs104886346
Biobankrs104886346
1000 genomesrs104886346
hgdprs104886346
ensemblrs104886346
gopubmedrs104886346
geneviewrs104886346
scholarrs104886346
googlers104886346
pharmgkbrs104886346
gwascentralrs104886346
openSNPrs104886346
23andMers104886346
23andMe allrs104886346
SNP Nexus

SNPshotrs104886346
SNPdbers104886346
MSV3drs104886346
GWAS Ctlgrs104886346
Max Magnitude0
ClinVar
Risk rs104886346(-;-)
Alt rs104886346(-;-)
Reference Rs104886346(GAAGGCCCTCCTGGGCCACCC;GAAGGCCCTCCTGGGCCACCC)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107846253_107846273del21
CLNSRC ClinVar
CLNACC RCV000021374.1,


[PMID 16941480] A two-tier approach to mutation detection in the COL4A5 gene for Alport syndrome.