Have questions? Visit https://www.reddit.com/r/SNPedia

ClinVar/Reports

From SNPedia


Name Significance Disease Normal S M R Risk S M R
Rs1021737 255 Homocysteine, total plasma, elevated Rs1021737(G;G) common in clinvar 0 Good Rs1021737(T;T) significantly higher plasma total homocysteine concentration 3 Bad
Rs1024611 255 Spina bifida, susceptibility to Coronary artery disease, modifier of Coronary artery disease, development of, in hiv Mycobacterium tuberculosis, susceptibility to Rs1024611(T;T) normal risk 0 Good Rs1024611(C;C) increased risk of exercise induced ischemia, Increased CCL2 levels; increased rate of HIV progression 2.2 Bad
Rs1041981 255 Myocardial infarction Rs1041981(C;C) normal Rs1041981(A;A) Higher myocardial infarction risk 2 Bad
Rs1042602 255 Skin/hair/eye pigmentation, variation in, 3 Tyrosinase-negative oculocutaneous albinism not provided not specified Rs1042602(C;C) None 0 Good Rs1042602(A;A) associated with the absence of freckles
Rs1042713 255 Asthma, nocturnal, susceptibility to Metabolic syndrome, susceptibility to salbutamol response - Efficacy salmeterol response - Efficacy Rs1042713(G;G) normal Rs1042713(A;A) 1.7x increased risk that pediatric inhaler use may make asthma worse 1.7 Bad
Rs1042714 255 Asthma, childhood, susceptibility to Metabolic syndrome, susceptibility to Obesity Rs1042714(G;G) complex; see details for increased risks Rs1042714(C;C) normal
Rs1044397 255 not specified Rs1044397(G;G) Rs1044397(A;A)
Rs1044498 255 Insulin resistance, susceptibility to Diabetes mellitus type 2 Obesity not specified Rs1044498(A;A) Rs1044498(C;C)
Rs1045485 255 Breast cancer, protection against Rs1045485(G;G) common/normal 0 Good Rs1045485(C;C) Reduced Risk of Breast Cancer 2 Good
... further results


Name Significance Disease Normal S M R Risk S M R
Rs10151259 5 Cone-rod dystrophy 13 not provided not specified Rs10151259(G;G) common in clinvar 0 Good Rs10151259(T;T) Recessive genotype uncertain pathogenicity 2 Bad
Rs10262966 5 Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis Rs10262966(A;A) common in clinvar 0 Good Rs10262966(G;G)
Rs1042695 5 Maturity-onset diabetes of the young, type 11 Maturity-onset diabetes of the young Rs1042695(T;T) common in clinvar 0 Good Rs1042695(G;G)
Rs104886042 5 Alport syndrome, X-linked recessive Rs104886042(G;G) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
Rs104886044 5 Alport syndrome, X-linked recessive Rs104886044(G;G) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
Rs104886045 5 Alport syndrome, X-linked recessive Rs104886045(C;C) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
Rs104886046 5 Alport syndrome, X-linked recessive Rs104886046(G;G) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
Rs104886047 5 Alport syndrome, X-linked recessive Rs104886047(T;T) common in clinvar 0 Good Rs104886047(C;C) Rs104886047(G;G)
Rs104886048 5 Alport syndrome, X-linked recessive Rs104886048(C;C) common in clinvar 0 Good Rs104886048(A;A)
... further results


Name Significance Disease Normal S M R Risk S M R
Rs104886318 4 Alport syndrome, X-linked recessive Rs104886318(-;-) common in clinvar 0 Good Rs104886318(G;G)
Rs104886326 4 Alport syndrome, X-linked recessive Rs104886326(-;-) common in clinvar 0 Good Rs104886326(GGGG;GGGG)
Rs104886328 4 Alport syndrome, X-linked recessive Rs104886328(-;-) common in clinvar 0 Good Rs104886328(C;C)
Rs104886330 4 Alport syndrome, X-linked recessive Rs104886330(AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA;AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA) common in clinvar 0 Good Rs104886330(;)
Rs104886353 4 Alport syndrome, X-linked recessive Rs104886353(GGACCAAATGGACAACCT;GGACCAAATGGACAACCT) common in clinvar 0 Good Rs104886353(;)
Rs104886354 4 Alport syndrome, X-linked recessive Rs104886354(AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA;AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA) common in clinvar 0 Good Rs104886354(;)
Rs104886357 4 Alport syndrome, X-linked recessive Rs104886357(T;T) common in clinvar 0 Good Rs104886357(G;G)
Rs104886364 4 Alport syndrome, X-linked recessive Rs104886364(GTGGTGTACCTGG;GTGGTGTACCTGG) common in clinvar 0 Good Rs104886364(AT;AT)
Rs104886373 4 Alport syndrome, X-linked recessive Rs104886373(AG;AG) common in clinvar 0 Good Rs104886373(;)
... further results


Name Significance Disease Normal S M R Risk S M R


Name Significance Disease Normal S M R Risk S M R
Rs1012729 2 not specified Rs1012729(G;G) altered pediatric blood pressure Rs1012729(A;A) normal
Rs1034762 2 not specified Rs1034762(T;T) Rs1034762(G;G) 0
Rs1042821 2 Lynch syndrome not provided not specified Hereditary cancer-predisposing syndrome Lynch syndrome I Rs1042821(C;C) common in clinvar 0 Good Rs1042821(G,T;G,T)
Rs1044009 2 not specified Rs1044009(C;C) Rs1044009(T;T)
Rs1047100 2 not specified Rs1047100(A;A) Rs1047100(G;G)
Rs1047286 2 C3 POLYMORPHISM, HAV 4-1 PLUS/MINUS TYPE Rs1047286(C;C) common in clinvar 0 Good Rs1047286(T;T) 1.7x increased risk for age-related macular degeneration 1.7 Bad
Rs1047781 2 SECRETOR/NONSECRETOR POLYMORPHISM, JAPANESE TYPE Rs1047781(A;A) ABH blood group "Secretor" status if Japanese 0 Good Rs1047781(T;T) ABH blood group "Non-Secretor" status if Japanese
Rs1048612 2 not specified Rs1048612(T;T) Rs1048612(C;C)
Rs10492396 2 Breast-ovarian cancer, familial 2 Rs10492396(G;G) common in clinvar 0 Good Rs10492396(A;A)
... further results



Name Significance Disease Normal S M R Risk S M R
Rs104895103 1 Familial Mediterranean fever not specified Rs104895103(A;A) common in clinvar 0 Good Rs104895103(C,G;C,G)
Rs104895431 1 Sarcoidosis, early-onset Rs104895431(C;C) Rs104895431(T;T)
Rs104895444 1 Sarcoidosis, early-onset Rs104895444(G;G) Rs104895444(A;A)
Rs10895322 1 not provided Rs10895322(A;A) common in clinvar 0 Good Rs10895322(G;G)
Rs111033850 1 Rs111033850(T;T) common in clinvar 0 Good Rs111033850(C;C)
Rs112563513 1 not provided Rs112563513(G;G) common in clinvar 0 Good Rs112563513(A;A)
Rs115232898 1 not provided Rs115232898(T;T) common in clinvar 0 Good Rs115232898(C;C)
Rs116840813 1 Rs116840813(A;A) common in clinvar 0 Good Rs116840813(G;G)
Rs116840814 1 Rs116840814(GA;GA) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
... further results



Name Significance Disease Normal S M R Risk S M R
Rs10306114 6 aspirin response - Efficacy Rs10306114(A;A) normal 0 Good Rs10306114(G;G) Higher risk of bleeding during coronary angiography 3 Bad
Rs1042522 6 not specified not provided Hereditary cancer-predisposing syndrome Li-Fraumeni syndrome 1 CODON 72 POLYMORPHISM, (rs1042522) paclitaxel response - Efficacy, Toxicity/ADR cyclophosphamide response - Efficacy, Toxicity/ADR antineoplastic agents response - Efficacy, Toxicity/ADR fluorouracil response - Efficacy, Toxicity/ADR cisplatin response - Efficacy, Toxicity/ADR Li-Fraumeni syndrome Rs1042522(C;C) Live 3 years longer. Chemotherapy is more effective. 3 Good Rs1042522(G;G) Common variant. Slightly shorter lifespan. 2 Bad
Rs10455872 6 hmg coa reductase inhibitors response - Efficacy Rs10455872(A;A) common/normal 0 Good Rs10455872(G;G) 2,57x increased Coronary Heart disease risk 3 Bad
Rs1045642 6 ondansetron response - Efficacy oxycodone response - Dosage methadone response - Dosage methotrexate response - Toxicity/ADR nevirapine response - Toxicity/ADR tramadol response - Dosage morphine response - Dosage digoxin response - Other opioids response - Dosage fentanyl response - Dosage Rs1045642(T;T) altered drug metabolism and bioavailability; moderately increased risk for certain cancers 3 Bad Rs1045642(C;C) increased risk of cannabis dependence, lower (normal) cancer risk 1
Rs10497203 6 radiotherapy response - Toxicity/ADR Rs10497203(A;A) common in clinvar 0 Good Rs10497203(C;C)
Rs1057910 6 Warfarin response Phenytoin response Glipizide poor metabolizer Tolbutamide response diclofenac response - Toxicity/ADR celecoxib response - Dosage Antiinflammatory agents, non-steroids response - Toxicity/ADR celecoxib response - Toxicity/ADR warfarin response - Dosage, Toxicity/ADR acenocoumarol response - Dosage, Toxicity/ADR Rs1057910(A;A) normal; no effect on warfarin metabolism 0.1 Good Rs1057910(C;C) CYP2C9*3 homozygote; average 80% reduction in warfarin metabolism; reduced metabolism of number of other drugs 4 Bad
Rs1065852 6 Debrisoquine, poor metabolism of Rs1065852(C;C) normal 0 Good Rs1065852(T;T) Homozygous for CYP2D6 decreased or non-functioning variants. 3.2 Bad
Rs1084004 3 not specified Rs1084004(T;T) common in clinvar 0 Good Rs1084004(C;C)
Rs111784356 3 not specified Rs111784356(G;G) common in clinvar 0 Good Rs111784356(A;A)
Rs113068438 3 Thoracic aortic aneurysm and aortic dissection Rs113068438(A;A) common in clinvar 0 Good Rs113068438(G;G)
Rs1135840 6 Debrisoquine, ultrarapid metabolism of Rs1135840(C;C) Homozygous for CYP2D6 variants (non-CYP2D6*1) 2 Rs1135840(G;G) normal 0 Good
Rs114575851 3 Cone dystrophy 3 Rs114575851(G;G) Rs114575851(C;C)
Rs11466445 3 not specified Loeys-Dietz syndrome Thoracic aortic aneurysm and aortic dissection Rs11466445(GGCGGCGGC;GGCGGCGGC) common in clinvar 0 Good [[]]
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
The page type input value ":" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
Rs115604088 3 Primary pulmonary hypertension Rs115604088(G;G) Rs115604088(A;A)
Rs11598702 6 gemcitabine response - Other Rs11598702(T;T) common in clinvar 0 Good Rs11598702(C;C)
Rs11615 6 platinum response - Efficacy, Toxicity/ADR carboplatin response - Efficacy, Toxicity/ADR Platinum compounds response - Efficacy, Toxicity/ADR cisplatin response - Efficacy, Toxicity/ADR oxaliplatin response - Efficacy, Toxicity/ADR Rs11615(T;T) common in clinvar 0 Good Rs11615(C;C)
Rs116855232 6 Thiopurines, poor metabolism of, 2 mercaptopurine response - Dosage, Toxicity/ADR azathioprine response - Dosage, Toxicity/ADR Rs116855232(C;C) common in clinvar 0 Good Rs116855232(T;T)
Rs118109635 3 not provided Rs118109635(G;G) common in clinvar 0 Good Rs118109635(A;A)
Rs11903223 3 not specified Rs11903223(T;T) Rs11903223(A;A) Rs11903223(G;G)
Rs12032814 3 not specified Rs12032814(T;T) common in clinvar 0 Good Rs12032814(A;A) Likely to be a benign variant 0 Good
Rs1217401 3 not specified Rs1217401(A;A) common in clinvar 0 Good Rs1217401(G;G)
Rs121913322 3 Hereditary cancer-predisposing syndrome not specified Peutz-Jeghers syndrome Rs121913322(C;C) normal 0 Good Rs121913322(A;A) Rs121913322(G;G) Rs121913322(T;T)
Rs121913421 6 Tyrosine kinase inhibitor response Rs121913421(GGAATTAAGAGAAGC;GGAATTAAGAGAAGC) common in clinvar 0 Good Rs121913421(;)
Rs121913422 6 Tyrosine kinase inhibitor response Rs121913422(AATTAAGAGAAGCAACAT;AATTAAGAGAAGCAACAT) common in clinvar 0 Good Rs121913422(;)
Rs121913424 6 Tyrosine kinase inhibitor response Rs121913424(AATTAAGAGAAGCAACATCT;AATTAAGAGAAGCAACATCT) common in clinvar 0 Good Rs121913424(TC;TC)
Rs121913425 6 Tyrosine kinase inhibitor response Rs121913425(AATTAAGAGAAGCAA;AATTAAGAGAAGCAA) common in clinvar 0 Good Rs121913425(;)
Rs121913434 6 Squamous cell carcinoma of the head and neck Rs121913434(C;C) common in clinvar 0 Good Rs121913434(G,T;G,T)
Rs121913435 6 Tyrosine kinase inhibitor response Rs121913435(ATTAAGAGAAG;ATTAAGAGAAG) common in clinvar 0 Good Rs121913435(GC;GC)
Rs121913436 6 Tyrosine kinase inhibitor response Rs121913436(GAATTAAGA;GAATTAAGA) common in clinvar 0 Good Rs121913436(;)
Rs121913438 6 Nonsmall cell lung cancer, response to tyrosine kinase inhibitor in, somatic Tyrosine kinase inhibitor response Rs121913438(TAAGAGAAGCAACATCTC;TAAGAGAAGCAACATCTC) common in clinvar 0 Good Rs121913438(;)
Rs121913440 6 Tyrosine kinase inhibitor response Rs121913440(TTAAGAGAAGCAACATCT;TTAAGAGAAGCAACATCT) common in clinvar 0 Good Rs121913440(;)
Rs121913442 6 Tyrosine kinase inhibitor response Rs121913442(ATTAAGAGAAGCAAC;ATTAAGAGAAGCAAC) common in clinvar 0 Good Rs121913442(;)
Rs121913444 6 Tyrosine kinase inhibitor response not specified Rs121913444(T;T) common in clinvar 0 Good Rs121913444(A,G;A,G)
Rs121913463 6 Tyrosine kinase inhibitor response Rs121913463(TCTCCGAAAGCCAACAAGGAAATC;TCTCCGAAAGCCAACAAGGAAATC) common in clinvar 0 Good Rs121913463(;)
Rs12777823 6 warfarin response - Dosage Rs12777823(G;G) common in clinvar 0 Good Rs12777823(A;A) Avoid Plavix, higher risk for adverse cardiovascular events. CYP2C19 poor metabolizer. 3.5 Bad
Rs12979860 6 peginterferon alfa-2a, peginterferon alfa-2b, ribavirin, and telaprevir response - Efficacy peginterferon alfa-2a, peginterferon alfa-2b, and ribavirin response - Efficacy Rs12979860(C;C) ~80% of such hepatitis C patients respond to treatment 2 Good Rs12979860(T;T) ~20-25% of such hepatitis C patients respond to treatment 3 Bad
Rs13306278 6 Selective serotonin reuptake inhibitors response - Efficacy Rs13306278(C;C) common in clinvar 0 Good Rs13306278(T;T)
Rs1346268 6 simvastatin response - Toxicity/ADR hmg coa reductase inhibitors response - Toxicity/ADR Rs1346268(T;T) common in clinvar 0 Good Rs1346268(C;C)
Rs1367117 3 not specified Familial hypercholesterolemia Rs1367117(G;G) common in clinvar 0 Good Rs1367117(A;A)
Rs139361635 3 Hypercholesterolaemia not provided not specified Familial hypercholesterolemia Rs139361635(G;G) common in clinvar 0 Good Rs139361635(A;A)
Rs139801276 6 Efavirenz response Rs139801276(T;T) common in clinvar 0 Good Rs139801276(C;C)
Rs140243105 3 Molybdenum cofactor deficiency, complementation group A Rs140243105(C;C) common in clinvar 0 Good Rs140243105(G,T;G,T)
Rs140329381 6 Fabry disease Deoxygalactonojirimycin response not specified Rs140329381(T;T) common in clinvar 0 Good Rs140329381(C;C)
Rs141156594 3 not specified Rs141156594(A;A) common in clinvar 0 Good Rs141156594(C,G;C,G)
Rs141392048 3 Dilated cardiomyopathy 3B Primary dilated cardiomyopathy Becker muscular dystrophy Duchenne muscular dystrophy not specified Cardiovascular phenotype Rs141392048(A;A) common in clinvar 0 Good Rs141392048(G;G)
Rs1414334 6 risperidone response - Toxicity/ADR antipsychotics response - Toxicity/ADR clozapine response - Toxicity/ADR Rs1414334(C;C) associated with metabolic syndrome when taking antipsychotics 2 Rs1414334(G;G)
Rs142511345 3 Congenital long QT syndrome Long QT syndrome not specified Rs142511345(G;G) common in clinvar 0 Good Rs142511345(A;A)
Rs142709940 3 not specified Rs142709940(C;C) common in clinvar 0 Good Rs142709940(A,T;A,T)
Rs144830948 3 not specified Rs144830948(G;G) common in clinvar 0 Good Rs144830948(A;A)
... further results


 ClinVar CLNSIGClinVar CLNDBNRefGenoRiskGenoGMAFOn microarray
rs2893547552-methyl-3-hydroxybutyric aciduriars28935475(C;C)Rs28935475(T;T)23andMe v1
Illumina Human 1M
23andMe v2
23andMe v3
23andMe v4
rs2893547652-methyl-3-hydroxybutyric aciduriars28935476(C;C)Rs28935476(G;G)23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs64675not specified
21-hydroxylase deficiency
rs6467(G;G)Rs6467(C;C)
rs6467(T;T)
0.336FTDNA2
HumanOmni1Quad
Illumina Human 1M
rs2893789953-Methylglutaconic aciduria type 3rs28937899(C;C)Rs28937899(T;T)23andMe v3
23andMe v4
rs289408925ACTH resistancers28940892(A;A)Rs28940892(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315785APOE2 VARIANTrs28931578(G;G)Rs28931578(A;A)
Rs28931578(C;C)
23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs289315775APOE3 VARIANTrs28931577(G;G)Rs28931577(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315765APOE3(-)-FREIBURGrs28931576(A;A)Rs28931576(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315795APOE4(+)rs28931579(A;A)Rs28931579(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs7694525APOE4(-)-FREIBURGrs769452(T;T)Rs769452(C;C)0.0013823andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289294765APOLIPOPROTEIN A-I (BALTIMORE)rs28929476(G;G)Rs28929476(T;T)23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315735APOLIPOPROTEIN A-I (MILANO)rs28931573(C;C)rs28931573(T;T)23andMe v2
23andMe v3
23andMe v4
rs289991135APRT deficiency, Japanese type
Adenine phosphoribosyltransferase deficiency
rs28999113(T;T)Rs28999113(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs20714215ARYLSULFATASE A POLYMORPHISM
Metachromatic leukodystrophy
not provided
not specified
rs2071421(A;A)rs2071421(G;G)0.20923andMe v1
Illumina Human 1M
23andMe v2
23andMe v3
HumanOmni1Quad
23andMe v4
Ancestry v2
rs289402825Acampomelic campomelic dysplasiars28940282(C;C)Rs28940282(T;T)23andMe v2
23andMe v3
23andMe v4
rs289316145Achondroplasia
Epidermal nevus
not provided
rs28931614(G;G)Rs28931614(A;A)
Rs28931614(C;C)
23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs289378895Acroerythrokeratodermars28937889(A;A)Rs28937889(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315815Acromesomelic dysplasia Maroteaux typers28931581(C;C)Rs28931581(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315825Acromesomelic dysplasia Maroteaux typers28931582(T;T)Rs28931582(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289294795Acromesomelic dysplasia Maroteaux typers28929479(T;T)Rs28929479(A;A)23andMe v1
23andMe v3
23andMe v4
Ancestry v2
rs289315905Acute myeloid leukemiars28931590(A;A)rs28931590(T;T)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs10646515Gaucher disease type 3C
Gaucher's disease, type 1
Acute neuronopathic Gaucher's disease
Subacute neuronopathic Gaucher's disease
Gaucher disease, perinatal lethal
Gaucher disease
not provided
rs1064651(G;G)rs1064651(C;C)23andMe v1
23andMe v3
23andMe v4
Ancestry v2
rs289345755Li-Fraumeni syndrome 1
Hereditary cancer-predisposing syndrome
Li-Fraumeni-like syndrome
Adenocarcinoma
Li-Fraumeni syndrome
not provided
rs28934575(G;G)Rs28934575(A;A)
Rs28934575(T;T)
23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs735983745Adenosine deaminase 2 allozymers73598374(G;G)Rs73598374(A;A)0.044123andMe v3
23andMe v4
Ancestry v2
rs93327395Age-related macular degeneration 14rs9332739(G;G)rs9332739(C;C)0.030323andMe v1
23andMe v2
23andMe v3
FTDNA2
FamilyTreeDNA
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs41516675Age-related macular degeneration 14rs4151667(T;T)rs4151667(A;A)0.029823andMe v1
23andMe v2
23andMe v3
FTDNA2
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs617485505not provided
Stargardt disease 1
Retinitis pigmentosa 19
Age-related macular degeneration 2
Cone-rod dystrophy 3
rs61748550(C;C)Rs61748550(T;T)23andMe v3
23andMe v4
Ancestry v2
rs289390725Age-related macular degeneration 3rs28939072(T;T)Rs28939072(C;C)23andMe v4
Ancestry v2
rs600951245not provided
Alexander's disease
rs60095124(A;A)Rs60095124(C;C)23andMe v3
23andMe v4
Ancestry v2
rs586459975not provided
Alexander's disease
rs58645997(G;G)Rs58645997(C;C)23andMe v3
23andMe v4
Ancestry v2
rs566790845not provided
Alexander's disease
rs56679084(G;G)Rs56679084(C;C)23andMe v3
23andMe v4
Ancestry v2
rs626357645not provided
Alexander's disease
rs62635764(G;G)Rs62635764(T;T)23andMe v3
23andMe v4
rs599857775not provided
Alexander's disease
rs59985777(T;T)Rs59985777(C;C)23andMe v3
23andMe v4
Ancestry v2
rs596614765not provided
Alexander's disease
rs59661476(T;T)Rs59661476(C;C)23andMe v3
23andMe v4
Ancestry v2
rs289327695Alexander's disease
not provided
rs28932769(T;T)Rs28932769(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs610603955not provided
Alexander's disease
rs61060395(T;T)Rs61060395(A,G;A,G)23andMe v3
23andMe v4
rs578151925not provided
Alexander's disease
rs57815192(A;A)Rs57815192(G,T;G,T)23andMe v3
23andMe v4
rs605515555not provided
Alexander's disease
rs60551555(T;T)Rs60551555(G;G)23andMe v3
23andMe v4
Ancestry v2
rs626365015not provided
Alexander's disease
rs62636501(A;A)Rs62636501(T;T)23andMe v3
23andMe v4
Ancestry v2
rs576617835not provided
Alexander's disease
rs57661783(G;G)Rs57661783(A,T;A,T)23andMe v3
23andMe v4
Ancestry v2
rs596281435not provided
Alexander's disease
rs59628143(A;A)Rs59628143(G;G)23andMe v3
23andMe v4
rs585369235not provided
Alexander's disease
rs58536923(A;A)Rs58536923(G;G)23andMe v3
23andMe v4
rs604492515not provided
Alexander's disease
rs60449251(T;T)Rs60449251(G;G)23andMe v3
23andMe v4
Ancestry v2
rs603432555not provided
Alexander's disease
rs60343255(C;C)Rs60343255(T;T)23andMe v3
23andMe v4
Ancestry v2
rs580084625Alexander's disease
not provided
rs58008462(T;T)Rs58008462(C;C)23andMe v3
23andMe v4
Ancestry v2
rs602698905not provided
Alexander's disease
rs60269890(T;T)Rs60269890(C;C)23andMe v3
23andMe v4
Ancestry v2
rs608251665not provided
Alexander's disease
rs60825166(C;C)Rs60825166(G;G)23andMe v3
23andMe v4
Ancestry v2
rs595689675not provided
Alexander's disease
rs59568967(T;T)Rs59568967(C;C)23andMe v3
23andMe v4
Ancestry v2
rs575909805not provided
Alexander's disease
rs57590980(A;A)Rs57590980(G;G)23andMe v3
23andMe v4
Ancestry v2
rs580756015not provided
Alexander's disease
rs58075601(G;G)Rs58075601(A,C;A,C)23andMe v3
23andMe v4
... further results